<?xml version="1.0" encoding="utf-8"?>



<feed xmlns="http://www.w3.org/2005/Atom"
    xmlns:fh="http://purl.org/syndication/history/1.0"
    xmlns:at="http://purl.org/atompub/tombstones/1.0">

    <title>Mullins Molecular Retrovirology Lab: Tissue Culture (BL3)</title>
    <subtitle>A personal publishing system for the modern web</subtitle>
    <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/feed" rel="self" />
    <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/feed" rel="current" />
    <link href="https://pubsubhubbub.superfeedr.com" rel="hub" />
    
    
    <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/" />
    
    <id>tag:hebe.mullins.microbiol.washington.edu,2019-03-04:protocols/tissue_culture_bl3</id>
    <updated>2015-05-05T14:22:47+00:00</updated>

    
    <entry>
        <title>Pairwise growth competition assay</title>
        <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/1725-Pairwise-growth-competition-assay" rel="alternate" type="text/html" />
        <published>2015-05-05T14:13:26-07:00</published>
        <updated>2015-05-05T14:22:47+00:00</updated>
        <id>urn:uuid:ed10a9a2-4181-58c9-b03e-9c3848083db1</id>
        <author><name>Mullins Admin</name></author>
        <content type="html">
<![CDATA[
<p><a href="https://www.jove.com/video/52610/pairwise-growth-competition-assay-for-determining-replication-fitness" title="Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses">Pairwise Growth Competition Assay for Determining the Replication
Fitness of Human Immunodeficiency
Viruses</a></p><p><strong>PROTOCOL:</strong></p><p><strong>*For figures and references, please check the paper
(</strong><a href="http://www.jove.com/video/52610"><strong>http://www.jove.com/video/52610</strong></a><strong>)
or the video</strong></p><p>This protocol is <a href="https://mullinslab.microbiol.washington.edu/protocols/Mullins-Manocheewa-Pairwise-growth-competition-assay.docx">also available as a Word
document</a>.</p><p>**<br>
**</p><p><strong>1)</strong> <strong>Construction of chimeric HIV-1 NL4-3 molecular clones</strong>  </p>
<hr>
<p><strong>1.1)</strong> <strong>Amplify insert DNA fragment</strong></p><p>1.1.1) Design chimeric primers. The 5&#39; halves of both forward and
reverse primers contain an HIV-1 vector sequence, at which the fragment
will be inserted. The 3&#39; half of the primers must contain the end of the
insert sequence (<strong>Figure 2</strong>). Make sure that the chimeric primer
sequence retains the original open reading frames.</p><p>1.1.1.1) Use primers at least 20 bases in length, with a melting
temperature greater than or equal to 60 Â°C, ~50% GC content, and a low
tendency to form primer dimers, heterodimers and/or hairpin structures.
These properties can be assessed using the OligoAnalyzer web tool
(https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/)</p><p>1.1.2) Use PCR<sup>27</sup> and the chimeric primers to amplify insert
DNA (<strong>Figure 2</strong>). For each PCR reaction, use 1X high fidelity buffer,
0.2 mM dNTPs, 1 U high fidelity DNA polymerase, 0.5 ÂµM of forward
chimeric primer, 0.5 ÂµM of reverse chimeric primer, and 1 pg - 10 ng of
DNA sample carrying insert region. Add dH<sub>2</sub>O to a final volume
of 50 Âµl.</p><p>1.1.3) Set thermal cycling steps as follows: Perform an initial DNA
denaturation step at 98 Â°C for 10 sec. Amplify with 30 cycles of DNA
denaturation at 98 Â°C for 10 sec and DNA annealing at 3 Â°C above the
lowest melting temperature of the two primers for 20 sec. Perform a
final extension at 72 Â°C for 10 min. Store PCR products at 4 Â°C.</p><p>1.1.4) Take 5 Âµl of the PCR products from the previous step and run
agarose gel electrophoresis<sup>28</sup>.</p><p>1.1.4.1) Use a 0.7% agarose gel, 1X TAE buffer (40 mM Tris-acetate, 1 mM
EDTA), 0.5 Î¼g/ml ethidium bromide (EtBr) final concentration and 1 kb
ladder as the DNA size marker. Set power source voltage to 5 V/cm
distance between electrodes. Stop the electrophoresis when the loading
dye migrates through about 2/3 of the gel length. Visualize the gel
using a gel documentation system<sup>28</sup>.</p><p>Note: EtBr is a suspected carcinogen and must be properly disposed of,
per institution regulations. Gloves should always be worn when handling
gels containing EtBr. Change to new gloves after finish handling EtBr
containing material and before handling other materials or equipment to
prevent cross contamination.</p><p>1.1.5) If only one DNA band with size corresponding to the desired PCR
product is detected, purify the rest of the PCR product using a
commercial kit such as QIAquick PCR Purification Kit according to the
manufacturer&rsquo;s protocols.</p><p>1.1.5.1) If other, non-specific bands are also present, use the rest of
the PCR product to run preparative gel electrophoresis. Use the same
parameters and conditions specified in step 1.1.4. Ensure that the gel
well is large enough to load ~45 Âµl of PCR products. Cut out the band
of interest and extract the DNA from the gel using QIAquick gel
extraction kit according to the manufacturer&rsquo;s protocols.  </p><p><strong>1.2)</strong> <strong>Introduce the insert fragment into full-length infectious
HIV-1 subtype B vector (pNL4-3)</strong></p><p>1.2.1) Use purified PCR products from step 1.1.5 as PCR primers. Use
pNL4-3VifA<sup>20</sup> as template DNA in one PCR reaction and use
pNL4-3VifB<sup>20</sup> as template in the other reaction (<strong>Figure
2</strong>). For each PCR reaction, use 1X high fidelity buffer, 0.2 mM dNTPs,
2 U high fidelity DNA polymerase, 500 ng of primer DNA and 50 ng of
template DNA in a final volume of 50 Âµl. Set the thermal cycling
parameters to: 98 Â°C for 30 sec, 35 cycles at 98 Â°C for 10 sec, 48 Â°C
for 1 min and 72 Â°C for 10 min, followed by 72 Â°C for 10 min.  </p><p>1.2.2) Add 10 U of <em>Dpn</em>I to 50 Âµl of the PCR reaction and incubate at
37 <sup>o</sup>C for 1 hr to digest the template DNA. Ensure that the
plasmid DNA is isolated from a methylation competent bacterial strain,
e.g., TOP10 chemically competent <em>Escherichia coli</em>.*  </p><p>*</p><p>1.2.3) Use <em>Dpn</em>I digested product to transform competent bacterial
cells. Use heat-shock transformation with TOP10 chemically competent <em>E.
coli</em>, according to the manufacturer&rsquo;s protocol. To select for bacterial
cells containing the recombinant plasmid, use Luria Broth (LB) culture
plates containing 100 mg/L carbenicillin.  </p><p>1.2.3.1) Pick ~10 well-separated colonies and grow each separately in 3
ml LB liquid medium containing 100 mg/L carbenicillin and incubate at 30
Â°C in a shaker overnight.*  </p><p>*</p><p>1.2.3.2) Use QIAprep Spin Miniprep kit to isolate plasmid DNA from the
bacterial liquid culture, according to the manufacturer&rsquo;s protocol.</p><p>1.2.4) Use double restriction digestion<sup>29</sup> to determine
whether the plasmid DNA contains the proper ** insert. Ensure that one
of the restriction sites exists only within the insert region and the
other restriction site exists only once in the HIV-1 vector, outside of
the insert region.</p><p>1.2.4.1) Digest at least 300 ng of plasmid DNA in a 10 Âµl final
reaction volume. Select restriction buffers, incubation temperature and
incubation time according to the manufacturer&rsquo;s protocol of the selected
restriction enzymes. Take 9 Âµl of the digested DNA and run gel
electrophoresis as described in step 1.1.4. Select recombinant plasmids
that have DNA bands of the predicted sizes.  </p><p>1.2.5) Confirm sequence integrity of the recombinant plasmids by Sanger
sequencing. While rare, unwanted mutation(s) can be introduced during
the PCR reactions.</p><p>1.2.5.1) Sequence both strands of the plasmid DNA. Follow instructions
in step 1.1.1.1 to design sequencing primers. In addition, ensure that
the forward and reverse sequencing primers anneal at least 50 bp
upstream and downstream of the insert region in the recombinant plasmid,
respectively.</p><p>1.2.5.2) Submit plasmid DNA and sequencing primers to a commercial DNA
sequencing service provider. Prepare DNA sample and primers as specified
by the service provider.</p><p>1.2.6) Make an endotoxin-free stock of the mutated plasmid DNA using an
Endotoxin free plasmid DNA kit according to manufacturer&rsquo;s protocol.
Prepare at least 1 Âµg of endotoxin-free plasmid DNA for transfection in
the following step.</p><p><strong>1.3)</strong> <strong>Introduce small-scale mutations via site-directed
mutagenesis</strong></p>
<hr>
<p>1.3.1) Design mutagenic primers with overlapping forward and reverse
primers containing the desired mutation(s). Position the base(s) to be
substituted, inserted, or deleted in the middle of the primers, flanked
by 10-15 homologous bases. Follow instructions in step 1.1.1.1.</p><p>1.3.2) Use PCR to synthesize mutant plasmids. For each PCR reaction, use
1X high fidelity buffer, 10 mM dNTPs, 2 U of high fidelity DNA
polymerase, 0.5 ÂµM of forward mutagenic primer, 0.5 ÂµM of reverse
mutagenic primer and 50 ng of chimeric pNL4-3VifB, from step 1.2.6, in a
final volume of 50 Âµl. Set the thermal cycling parameters to: 98 Â°C
for 30 sec, 25 cycles at 98 Â°C for 10 sec, 48 Â°C for 1 min and 72 Â°C
for 10 min, followed by 72 Â°C for 10 min.</p><p>1.3.3) Repeat step 1.2.2 to 1.2.6.</p><p><strong>2)</strong> <strong>Generation of viral stock using transfection</strong></p><p>2.1) Calculate the amount of viral stock desired and plasmid DNA
required. With a viral titer of 10<sup>4</sup> IU/ml or higher, 1.8 ml
of viral stock is sufficient for two sets of growth competition assays,
including monoinfections, each done in triplicate. For a transfection
done in a 6-well plate, about 1.8 ml supernatant is harvested per well.
One Âµg of plasmid DNA is needed for each transfection done in a 6-well
plate.  </p><p>2.2) For each well of a 6-well plate, prepare 100 Âµl of transfection
mixture, e.g., consisting of 1 Âµl X-tremeGENE 9 transfection reagent
(or comparable product), 1 Âµg of plasmid DNA and serum-free DMEM.</p><p>2.2.1) Determine the volume of plasmid DNA needed, using 1 Âµg plasmid
DNA per well. Ensure that the final concentration of the plasmid DNA is
at least 50 ng/Âµl.  </p><p>2.2.2) Determine how much serum-free medium (DMEM) is needed per well
using the formula: Total volume of DMEM in Âµl = 100 ÂµL - DNA volume in
Âµl.  </p><p>2.3) Add 10<sup>6</sup> HEK 293T-17 (ATCC) cells/well in 2 ml of
propagation medium (DMEM + 10% fetal bovine serum (FBS)) into a 6-well
plate. Incubate for 1 hr at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere. Seed as many wells as needed (determined in step 2.1).  </p><p>2.4) To prepare the transfection mixture, aliquot the appropriate volume
of serum-free DMEM, as calculated above, into a 1.8 ml polypropylene
microcentrifuge tube, and then add the transfection reagent.  </p><p>2.4.1) Pipette reagent directly into the media solution, do not add it
to the plastic surface of the microcentrifuge tube. Add plasmid DNA
last. Pipet up and down gently to mix the solution. Incubate for 15 min
at room temperature (15 <sup>o</sup>C to 25 <sup>o</sup>C) to allow the
formation of transfection complexes.  </p><p>2.4.2) Add the mixture in a drop-wise manner to cells seeded in the
6-well plate. Gently shake or swirl the wells to ensure even
distribution of transfection complexes.  </p><p>2.4.3) Seal plates with plastic wrap.  </p><p>2.5) Incubate cultures at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere for 48
hr.<span id="Wash_optional"></span><span id="Harvest_day_2"></span>  </p><p>2.6) Use a pipette to carefully collect and transfer supernatant to a 15
ml tube through a 0.22 Âµm filter top<em>.</em>  </p><p>2.7) Use pipette to transfer 250 Âµl or more of the filtered supernatant
to 1.8 ml microfuge tubes with rubber gaskets in the lids.  </p><p>2.8) Store filtered supernatants at -80 <sup>o</sup>C until use.**</p>
<hr>
<p><strong>3)</strong> <strong>Determine infectious titer of viral stocks on peripheral blood
mononuclear cells (PBMCs)</strong></p>
<hr>
<p>3.1) Stimulate PBMCs with phytohemagglutinin (PHA). Per one viral stock,
seed 2 x 10<sup>6</sup> PBMCs in complete Iscove&rsquo;s Modified Dulbecco&rsquo;s
Medium (cIMDM; IMDM supplemented with 20 U/ml of human interleukin 2
(hIL-2), 10% fetal bovine serum and 1% penicillin/streptomycin)
supplemented with PHA (1.5 Âµg/ml). Seed PBMCs at 2 x 10<sup>6</sup>
cells/ml. Incubate PBMCs at 37 <sup>o</sup>C in a 5% CO<sub>2</sub> ****
atmosphere **** for 72 hr.</p><p>3.2) Harvest PHA stimulated PBMCs. Transfer non-adherent PHA-PBMCs to a
50 ml conical tube. Spin tube at 228 x g for 10 min. Carefully remove
supernatant without disrupting the cell pellet. Re-suspend the cell
pellet to a final concentration of 2 x 10<sup>5</sup> PBMCs/ml in cIMDM.</p><p>3.3) Seed 2x10<sup>4</sup> PHA stimulated PBMCs/well in 100 Âµl/well
cIMDM in a round bottom 96-well plate.  </p><p>3.4) Make a 1:10 dilution of the viral stock. Then, from the first
diluted stock, make twelve 3-fold serial dilutions in a 96-well master
plate. This dilution scheme is recommended for detecting viral titers in
the range of 10<sup>4</sup> to 10<sup>6</sup> infectious unit (IU) per
ml. For example, add 20 Âµl of virus stock to 180 Âµl media in the 1.5
ml tube. Mix the dilution by pipetting carefully. Then transfer 90 Âµl
of the diluted stock into 180 Âµl media of the first well and mix well
by pipetting. Continue dilution series by transferring 90 Âµl from the
current well to 180 Âµl media in the next well eleven more times.
Increase or decrease the initial dilution if titers higher than
10<sup>6</sup> IU/ml or lower than 10<sup>4</sup> IU/ml are expected,
respectively.  </p><p>3.5) Add 40 Âµl of the serially diluted viral stock from the master
dilution plate to the seeded PBMCs plate (from step 3.3) in
quadruplicate. Incubate plates at 37 <sup>o</sup>C in a 5%
CO<sub>2</sub> **** atmosphere **** for 16-24
hr.<span id="d1_wash_optional"></span>  </p><p>3.6) Carefully remove 100 Âµl supernatant from each well, and replace
with 160 Âµl fresh cIMDM to a total volume of 200 Âµl/well. Incubate
plates at 37 <sup>o</sup>C with 5% CO<sub>2</sub> **** atmosphere (day
1).  </p><p>3.7) On days 4, 7, 10 and 13
<span id="d2_4_7_10_treatment"></span>transfer 100 Âµl supernatant from
each well to 100 Âµl disruption buffer (2 % TritonX-100 in PBS), and
replace with 100 Âµl fresh cIMDM. Store the supernatants at -20
<sup>o</sup>C.</p><p>3.7.1) Keep sampling and adding fresh cIMDM every three days until the
titer stabilizes.</p><p>3.8) Determine the 50% tissue culture infectious dose
(TCID<sub>50</sub>) of the viral stock by p24 ELISA using the day 7 and
13 samples as described in step 4.</p><p>3.8.1) If the TCID<sub>50</sub> obtained from day 13 is clearly higher
than the titer from day 7, the virus stock may need a longer time to
expand. Repeat the p24 ELISA using later samples until the infectious
titers from two sampling time points become stable (or decrease). Stocks
should be selected from samples with the highest titers.  </p><p>4) **ELISA (Enzyme-linked Immunoabsorbant assay) detection of HIV-1 p24
for determining viral infectious titer  </p><p>**Note: The following protocol was developed using p24 antigen capture
plates prepared in our laboratory<sup>30</sup>. Commercial HIV-1 p24
ELISA plate/kits can also be used, following the manufacturer&rsquo;s
protocol.  </p><p>4.1) Prior to working with samples, prepare working stocks of primary
antibody (rabbit anti-HIV-1 SF2 p24 antiserum).</p><p>4.1.1) Thaw p24 antiserum at room temperature (RT).</p><p>4.1.2) Mix 2.5 ml glycerol with 2 ml 10% FBS in phosphate buffer saline
(PBS).</p><p>4.1.3) Add 0.5 ml antiserum and mix.</p><p>4.1.4) Store 1 ml aliquots at -20 <sup>o</sup>C.</p><p>4.2) Thaw samples from step 3.7 in 37 <sup>o</sup>C incubator.</p><p>4.3) Wash the p24 capture plate 5 times with wash buffer (1x PBS with
0.05% Tween-20).  </p><p>4.4) Add 50 Âµl/well of sample diluent (1% bovine serum albumin (BSA),
0.2% Tween-20 in RPMI-1640), then add 50 Âµl of sample to appropriate
wells. Include at least three wells with sample diluent only as mock /
negative controls. Incubate for 2 hr at 37 <sup>o</sup>C or overnight at
4 <sup>o</sup>C.</p><p><span id="Add_primary_Ab"></span>4.5) Prepare the primary antibody
solution fresh before use. Make a 1:2,000 fold dilution of the primary
antibody working stocks using the primary antibody diluent (12% FBS in
RPMI-1640). Ensure to prepare enough for the use of 100 Âµl solution per
each sample/control well in a 96-well plate.</p><p>4.5.1) For example, to make enough solution for one 96-well plate, add 5
Âµl of the primary antibody working stocks to the primary antibody
diluent for a final volume of 10 ml.</p><p>4.6) Wash capture plate 5 times with wash buffer.  </p><p>4.7) Add 100 Âµl of the primary antibody solution to each well. Incubate
for 1 h at 37 <sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere.  </p><p><span id="Add_secondary_Ab"></span>4.8) Prepare the secondary antibody
solution fresh before use. Make a 1:14,400 fold dilution of the
secondary antibody (1 mg/ml Goat anti-rabbit HRP) using the secondary
antibody diluent (7 % FBS, 0.01 % Tween-20 in RPMI-1640). To reduce
pipetting errors, perform a two-step serial dilution. Ensure to prepare
enough for the use of 100 Âµl solution per each sample/control well in a
96-well plate.</p><p>4.8.1) For example, to make enough solution for one 96-well plate, first
add 1 Âµl of the secondary antibody to 99 Âµl of the secondary antibody
diluent. Then add 70 Âµl of first dilution to the secondary antibody
diluent for a final volume of 10 ml.  </p><p>4.9) Wash capture plate 5 times with wash buffer.  </p><p>4.10) Add 100 Âµl of the secondary antibody solution to each well.
Incubate for 1 hr at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere.  </p><p>4.11) Wash plate 5 times with wash buffer.  </p><p>4.12) Add<span id="Add_substrate"></span> 100 Âµl of room temperature
TMB substrate. Incubate 30 min at room temperature in a closed container
to protect from light.  </p><p><span id="Add_stop"></span>4.13) Add 100 Âµl of room temperature stop
solution (1 N H<sub>2</sub>SO<sub>4</sub>).  </p><p>4.14) Read absorbance at 450-650 nm in each well using a microplate
reader. Use the absorbance value to score each well as infected or
uninfected. A well is considered to contain infectious virus if the
absorbance value is at least three times higher than the value read from
mock / negative control wells. Calculate TCID<sub>50</sub> of the viral
stock using the Reed-Meunch method<sup>31</sup>.  </p><p>5) **Establish viral growth kinetics  </p><p>**</p><p><span id="d14_treatment"></span><span id="Suppliments"></span><strong>5.1)</strong>
<strong>Monoinfection</strong></p><p>5.1.1) Seed 3x10<sup>5</sup> PHA-stimulated PBMC/well in 48-well plates
in a total volume of 500 Âµl/well. Keep the culture plates at 37
<sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere until inoculation.  </p><p>5.1.2) For each virus, prepare an inoculum containing 6,000 IU in 2 ml
of cIMDM.  </p><p>5.1.3) Inoculate wells in triplicate by adding 500 Âµl of the inoculum
(1,500 IU) to the seeded cells. The final volume of the infected cell
culture is 1 ml/well and the MOI is 0.005.  </p><p>5.1.4) Aliquot 200 Âµl of the remaining inoculum to each of two 96-well
plates for RNA isolation, one of which is saved as a backup.  </p><p>5.1.5) Incubate cultures at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere for 16-24 h.  </p><p>5.1.6) Wash cultures 16-24 h after inoculation.</p><p>5.1.6.1) Remove and discard 750 Âµl of culture supernatant.  </p><p>5.1.6.2) Add 750 Âµl of fresh cIMDM. Wrap plates in plastic wrap and
spin for 10 minutes at 300 x g. Remove and discard 750 Âµl
supernatant.  </p><p>5.1.6.3) Add 750 Âµl of fresh cIMDM. Incubate at 37 <sup>o</sup>C with a
5% CO<sub>2</sub> atmosphere (day 1)**.  </p><p>**</p><p><span id="Daily_Treatment"></span>5.1.7) Sample cultures daily from day
2 to day 7.  </p><p>5.1.7.1) Transfer 500 Âµl of culture supernatant to a 1.8 ml centrifuge
tube. Spin for 1 min at 3000 x g.  </p><p>5.1.7.2) Transfer 200 Âµl of the cell-free supernatant to the two
96-well sample plates for RNA isolation, again saving one plate as
backup. Store supernatants at -80 <sup>o</sup>C until RNA isolation.  </p><p>5.1.7.3) Add 500 Âµl fresh cIMDM to each culture. Incubate at 37
<sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere.  </p><p>5.1.7.4) Discard cultures into Wescodyne at the end of the experiment.  </p><p>5.1.7.5) Isolate RNA from 200 Âµl of supernatant (use commercial kits
such as QIAamp Viral RNA Mini Kit) following the manufacturer&rsquo;s standard
protocol. For a large number of samples, use the Qiagen QIAxtractor.  </p><p>5.1.7.6) Store RNA samples at -80 <sup>o</sup>C until cDNA synthesis.  </p><p><strong>5.2)</strong> <strong>cDNA synthesis (Reverse transcription)</strong></p><p>5.2.1) For each RNA sample, add 1.2 nmol of dNTP and 1.2 pmol of cDNA
synthesis primer, (5&#39;-GTTGATCCTTTAGGTATCTTTCCACAGC-3&#39;, HXB2 nucleotide
7968 to 7995) to 10 Âµl of viral RNA. Add water to a final volume of 14
Âµl. Flick the tube to mix and spin briefly to collect liquid at the
bottom of the tube.  </p><p>5.2.2) Incubate mixture for 5 min at 65 <sup>o</sup>C, then hold at 4
<sup>o</sup>C until the master mix is prepared.  </p><p>5.2.3) Prepare master mix using 5x first-strand buffer (250 mM Tris-HCl,
pH 8.3, 375 mM KCl, 15 mM MgCl<sub>2</sub>), 5 mM DTT, 120 U of
SuperScriptIII and 240 U of Rnase inhibitor. Add water to final volume
of 10 Âµl.  </p><p>5.2.4) Add 10 Âµl of master mix to RNA mixture, flick to mix and spin to
collect.  </p><p>5.2.5) Incubate mixture for 90 min at 50 <sup>o</sup>C to allow
synthesis of cDNA. Incubate for 15 minutes at 70 <sup>o</sup>C to
inactivate reverse transcriptase. Hold at 4 <sup>o</sup>C as needed.  </p><p>5.2.6) Add 2 U of Rnase H, flick to mix, and then spin to collect.  </p><p>5.2.7) Incubate 20 min at 37 <sup>o</sup>C. Store cDNA at -20
<sup>o</sup>C.  </p><p><strong>5.3)</strong> **cDNA quantitation using qPCR system  </p><p>**</p><p>5.3.1) Prepare a standard dilution series. Do 10-fold serial dilution,
from 3 x 10<sup>6</sup> copies/Âµl down to 30 copies/Âµl, of pNL4-3VifA.
Use distilled water for dilutions. Prepare the standard dilution series
fresh before use or prepare small batches and keep at -20 <sup>o</sup>C.
Do not freeze-thaw the standards more than three times.</p><p>5.3.2) Set up a 96-well qPCR reaction plate. Ensure that each plate
contains at least one well of negative controls, a triplicate of the
standard dilution series, and at least a duplicate of each cDNA sample.</p><p>5.3.3) For each qPCR reaction, use 12.5 Âµl of qPCR master mix, 0.2 ÂµM
probe, 0.8 ÂµM each of the forward and reverse primers and 1 Âµl of cDNA
or the standard dilution series or water/buffer (for the negative
control well). Add water to a final volume of 25 Âµl. The qPCR probe is
light sensitive. Keep it in closed container.</p><p>5.3.3.1) To detect cDNA derived from pNL4-3VifA based molecular clone,
use the VifA primer-probe: VifAB forward primer
(GGTCTGCATACAGGAGAAAGAGACT), VifA reverse primer
(5&#39;-AGGGTCTACTTGTGTGCTATATCTCTTTT-3&#39;) and VifAB probe
(6FAM-5&#39;-CTCCATTCTATGGAGACTC-3&#39;-MGBNFQ). For cDNA derived from
pNL4-3VifB based clone, use the VifB primer-probe: VifAB forward primer,
VifAB probe and VifB reverse primer (5&#39;-CACCTGCGTGCTATACCTTTTCT-3&#39;).  </p><p>5.3.4) Set PCR cycling parameters to 50 <sup>o</sup>C for 2 min, 95
<sup>o</sup>C for 10 min, and 40 cycles of 95 <sup>o</sup>C for 15 sec
and 60 <sup>o</sup>C for 1 min. Consult the manufacturer&rsquo;s support
document for operation of the qPCR machine.</p><p>5.3.5) Calculate a standard curve using data from the triplicate
standard dilution series. Compare amplification data of the cDNA sample
to the standard curve to determine the copy number. Consult the
manufacturer&rsquo;s support document for data processing.  </p><p><strong>5.4)</strong> **Determine viral exponential growth phase  </p><p>**</p><p>5.4.1) Plot viral growth kinetics with the sampling day along the X-axis
and the cDNA copy number along the Y-axis and identify the viral
exponential growth phase, i.e., when viral cDNA copy numbers increase in
an exponential progression.</p><p>5.4.2) Use the GRC web tool
(<a href="http://indra.mullins.microbiol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/</a>) to calculate
viral growth rate (<em>g</em>). In this application, the GRC tool accepts cDNA
copy numbers from at least two time points as input, and outputs the
viral growth rate (<em>g</em>). Use only time point data within the exponential
growth phase (see step 5.4.1 above) to obtain accurate growth rates. For
a detailed description of the mathematical model used in the GRC web
tool, see<sup>20</sup>.  </p><p><strong>6)</strong> **Growth Competition Assay  </p><p>**</p><p>6.1) Seed 3 x 10<sup>5</sup> PHA-stimulated PBMCs (or 1 x 10<sup>5</sup>
CEMx174 cells<em>)</em> in 500 Âµl total volume per well in a 48 well
flat-bottomed plate.*  </p><p>*</p><p>6.2) Keep plate in 37 <sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere
until inoculation.  </p><p>6.3) For each virus, prepare 3 ml of inoculum containing 6,000 IU.  </p><p>6.4) Transfer 1.5 ml of each viral inoculum to a sterile tube to create
the dual infection inoculum. Add 500 Âµl of the dual inoculum (1,500 IU)
to 3 x 10<sup>5</sup> cells in a 48-well plate. The final culture volume
is 1 ml/well. Aliquot 200 Âµl of the inoculum to two 96-well plates for
RNA isolation; save one plate as a back up.  </p><p>6.5) Incubate inoculated cells at 37 <sup>o</sup>C with a 5%
CO<sub>2</sub> atmosphere for 16-24 hr.</p><p>6.6) Wash cultures 16-24 h after inoculation.</p><p>6.6.1) Remove and discard 750 Âµl of culture supernatant.  </p><p>6.6.2) Add 750 Âµl of fresh cIMDM. Wrap plates in plastic wrap and spin
for 10 minutes at 300 x g. Remove and discard 750 Âµl supernatant.</p><p>6.6.3) Add 750 Âµl of fresh cIMDM. Incubate at 37 <sup>o</sup>C with a
5% CO<sub>2</sub> atmosphere (day 1)<strong>.</strong></p><p>6.7) Select sampling times to include at least 3 time points within the
exponential growth phase observed in step 5.4.1.  </p><p>6.7.1) For each sampling, follow step 5.1.7.  </p><p>6.8) Perform cDNA synthesis as described in section 5.2.  </p><p>6.9) Determine the viral variant ratio using qPCR.</p><p>6.9.1) Prepare a standard serial dilution series in triplicate, diluting
10-fold in each step from 3 x 10<sup>6</sup> copies/Âµl to 30 copies/Âµl
of pNL4-3VifA.</p><p>6.9.2) Set up a 96-well qPCR reaction plate. Ensure that each plate
contains at least one negative control, the standard dilution series in
triplicate, and duplicates of each cDNA sample.</p><p>6.9.3) For each qPCR reaction, use 12.5 Âµl of qPCR Master Mix, 0.2 ÂµM
probe, 0.8 ÂµM each of the forward and reverse primers and 1 Âµl of cDNA
or the standard dilution series or water/buffer (for the negative
control wells). Add water to a final volume of 25 Âµl. The qPCR probe is
light sensitive, keep it in closed container.</p><p>6.9.3.1) Use the VifA primer-probe to detect signals in the negative
controls and the standard dilution series and with one duplicate of the
cDNA sample. Use the VifB primer-probe with the other duplicate of the
cDNA sample.  </p><p>6.9.4) Set PCR cycling parameters to 50 <sup>o</sup>C for 2 min, then 95
<sup>o</sup>C for 10 min, and then 40 cycles of 95 <sup>o</sup>C for 15
sec and 60 <sup>o</sup>C for 1 min. Consult the manufacturer&rsquo;s support
document for operation of the qPCR machine.</p><p>6.9.5) Calculate the standard curve using amplification data from the
standard dilution series. Compare amplification data of the cDNA samples
to the standard curve to determine copy number. Consult the
manufacturer&rsquo;s support document for data processing.</p><p>6.9.6) Use the GRC web tool
(<a href="http://indra.mullins.microbiol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/</a>) to calculate
relative viral fitness (<em>d</em>). The GRC tool accepts cDNA copy numbers or
chromatogram peak heights from at least two time points as the input,
and outputs the net growth rate difference (<em>d</em>) between the two
viruses. While the tool can calculate the net growth rate from two time
point data, it is strongly recommended to input data from three or more
time points. Use only data obtained from time points within the
exponential growth phase (see step 5.4) to obtain accurate growth rates.
For a detailed description of the mathematical model used in the GRC web
tool, see<sup>20</sup>.</p><p>6.10) Determine viral ratios using chromatogram peak-heights</p><p>6.10.1) PCR amplify HIV-1 <em>vif</em> fragments containing the VifAB sequence
tag using VifFwd (5â€²-GAAAGAGACTGGCATTTGGGTCAGGG-3â€²; HXB2 positions
5266-5291) and VifRev primers (5â€²-GTCTTCTGGGGCTTGTTCCATCTGTCC-3â€²;
HXB2 positions 5579-5553).</p><p>6.10.1.1) For each PCR reaction, use 1 Âµl of cDNA, 1X NH<sub>4</sub>
buffer, 1.5 mM MgCl<sub>2</sub>, 0.2 mM dNTP, 2.5 U of Taq Polymerase,
and 0.45 ÂµM of each primer. Add water to a final volume of 50 Âµl.  </p><p>6.10.1.2) Set PCR cycling parameters to 3 cycles at 94 <sup>o</sup>C for
1 min, 55 <sup>o</sup>C for 1 min, and 70 <sup>o</sup>C for 1 min,
followed by 34 cycles at 94 <sup>o</sup>C for 15 sec, 58 <sup>o</sup>C
for 30 sec, and 70 <sup>o</sup>C for 1 min, and then hold at 4
<sup>o</sup>C.  </p><p>6.10.2) Purify PCR products using the QIAquick PCR purification kit
according to the manufacturer&rsquo;s protocol.</p><p>6.10.3) Submit purified PCR products to a DNA sequencing service
provider for Sanger sequencing.</p><p>6.10.4) Check the average read quality score, which should be provided
by the sequencing service. If the average base call accuracy is less
than 85%, redo step 6.10.1 to 6.10.3</p><p>6.10.5) Use the ChromatQuant web tool
(<a href="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi</a>)
to calculate viral ratio at each time point. The tool requires the
sequence trace file (*.ab1) and the sequence 5&#39; to the nucleotide site
of interest. The tool measures the peak intensity at the specified site.
The ratio of the peak intensity corresponds to the ration of the two
viruses <strong>(Figure 4B).</strong></p><p>6.10.6) Use the GRC web tool
(<a href="http://indra.mullins.microbiol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/</a>) and the recorded
peak intensities as the input to calculate viral relative fitness (<em>d</em>).
See step 6.10.6.<sup>20</sup></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Determining Coreceptor Usage of HIV-1 on U87 Glioma Cells</title>
        <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/429-Determining-Coreceptor-Usage-of-HIV-1-on-U87-Glioma-Cells" rel="alternate" type="text/html" />
        <published>2010-03-30T14:49:58-07:00</published>
        <updated>2011-06-03T16:09:18+00:00</updated>
        <id>urn:uuid:58e8e370-2e62-57d8-8863-906ebaff36d4</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents:</strong></span></p>
<ul>
<li><p>U87 T4 co-receptor cell lines (mycoplasma free):</p></li>
<li><p>CD4 only</p></li>
<li><p>CD4 plus CCR1</p></li>
<li><p>CD4 plus CCR2b</p></li>
<li><p>CD4 plus CCR3</p></li>
<li><p>CD4 plus CCR5</p></li>
<li><p>CD4 plus CXCR4</p></li>
<li><p>cDMEM (DMEM, 10% FBS, 100 U/ml penicillin, 100 Âµg/ml streptomycin,
L-Glutamine, 10mM HEPES)</p></li>
<li><p>Sterile TC 1x PBS.</p></li>
<li><p>1x Trypsin.</p></li>
<li><p>Geneticin (G418), 300 Âµg/ml final concentration.</p></li>
<li><p>Puromycin, 1 Âµg/ml final concentration.</p></li>
<li><p>96-well microtiterplate with lid (flat bottom), Nuclon, Nunc.</p></li>
<li><p>24-well plate with lid (flat bottom), Costar?</p></li>
</ul>
<p><span class="underline"><strong>Passaging:</strong></span></p>
<ol>
<li><p> U87 cell stocks are cultured in T25 flasks in 7ml cDMEM with G418
for all cell lines and puromycin for all except parental U87 T4.</p></li>
<li><p> For passaging, wash monolayer with 5ml warm PBS.</p></li>
<li><p> Add 0.5ml 1X Trypsin.</p></li>
<li><p> Incubate 2 minutes at room temperature.</p></li>
<li><p> Confirm that all cells detach.</p></li>
<li><p> Add 2ml cDMEM and pipette up and down to completely resuspend all
cells.</p></li>
<li><p> Use 250 Âµl cell suspension to continue culture. Add 7ml cDMEM and
antibiotics.</p></li>
<li><p> Pellet cells not used for passaging and resuspend at appropriate
concentration for further use (i.e. 1 x 10<sup>5</sup>/ml for
co-receptor assay).</p></li>
</ol>
<p><span class="underline"><strong>Co-receptor assay:</strong></span></p>
<ol>
<li><p> Per virus per cell line: plate out 1 x 10<sup>4</sup> cells (100
Âµl) in cDMEM with antibiotics in 96-well plate.</p></li>
<li><p>Inoculate with at least 100 TCID<sub>50</sub> (in no more than 100
Âµl).</p></li>
<li><p>After 24 hours wash with warm PBS.</p></li>
<li><p>Add 200 Âµl fresh cDMEM with antibiotics.</p></li>
<li><p>After 3 and 7 days, take p24 sample. Store at -20Â°C.</p></li>
<li><p>After 7 days, score cytopathic effect.</p></li>
<li><p>Wash monolayer with warm PBS.</p></li>
<li><p>Add 50 Âµl 1x Trypsin.</p></li>
<li><p>Incubate 2 minutes at room temperature.</p></li>
<li><p>Transfer each well to a new well in a 24-well plate.</p></li>
<li><p>Add 2 ml cDMEM with antibiotics</p></li>
<li><p>After 10, 14, 17 and 21 days, take p24 samples. Store at -20Â°C.</p></li>
<li><p>After 14 and 21 days, score cytopathic effect.</p></li>
<li><p>Assay p24 production and discard cultures.</p><p>For specifics on appropriate handling and waste procedures please
see the <a href="http://mullinslab.microbiol.washington.edu/sops/ChemSOP.htm">online chemical
SOPs</a>
or our waste and spill notebook located in room 352.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Biological Cloning of HIV-1</title>
        <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/882-Biological-Cloning-of-HIV-1" rel="alternate" type="text/html" />
        <published>2010-03-30T14:48:21-07:00</published>
        <updated>2012-03-09T10:05:39+00:00</updated>
        <id>urn:uuid:173ae0ee-583a-574d-a625-f98258f9201b</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong><span class="underline">Materials:</span></strong></p>
<h3>Equipment</h3>

<ul>
<li><p>Single channel pipette: 0.5-10 Âµl, 10-100 Âµl, 200-1000 Âµl,
Eppendorf</p></li>
<li><p>Multichannel pipette: 5-50 Âµl, 50-300 Âµl, Finnpipette, Labsystems</p></li>
<li><p>Burker Bright-line Count-chamber, Labor Optik</p></li>
<li><p>Adjustable waterbath (37Â°C)</p></li>
<li><p>Rotixa/RP centrifuge, Hettich</p></li>
<li><p>37Â°C/5% CO<sub>2</sub> incubator, Brouwer Scientific</p></li>
<li><p>Biosafety cabinet, Clean Air</p></li>
<li><p>Sterile tray</p></li>
</ul>

<h3>Disposables</h3>

<ul>
<li><p>Disposable pipette: 1, 2, 5, 10, 25, 50 ml, Falcon</p></li>
<li><p>Pipette tips: 1-200 Âµl, Costar</p></li>
<li><p>Propylene conical tubes: 15 ml, 50 ml, Falcon/Nunclon</p></li>
<li><p>Sterile solution basins, individually wrapped, Labcor</p></li>
<li><p>Microtiter plate: 96-well flat bottom with lid, Nunclon, Nunc</p></li>
<li><p>Tissue culture flask: 25 cm<sup>2</sup>, 75 cm<sup>2</sup>, 175
cm<sup>2</sup>, Nunc</p></li>
</ul>

<h3>Reagents</h3>

<ul>
<li><p>Complete IMDM = IMDM + 10% FBS + Pen/Strep + 5 Âµg/ml Polybrene</p></li>
<li><p>PHA, use in complete IMDM at 1 Âµg/ml, Murex (HA16/17)</p></li>
<li><p>rIL-2, use in complete IMDM at 20 U/ml, Boehringer Mannheim</p></li>
</ul>
<p><strong><span class="underline">Protocol:</span></strong></p>
<h3>Prepare PHA-stimulated target cells</h3>

<ol>
<li><p> Isolate PBMC by separation over Ficoll gradient</p></li>
<li><p> Resuspend cells in complete IMDM with PHA, 3 to 5 x
10<sup>6</sup>/ml</p></li>
<li><p> Incubate 2 to 3 days at 37 Â°C/5% CO<sub>2</sub></p></li>
<li><p> Spin 10 minutes at 1500 rpm</p></li>
<li><p> Resuspend cell pellet in complete IMDM with rIL-2</p></li>
<li><p> 10 x 10<sup>6</sup> cells in 10 ml are needed per 96-well plate (100
Âµl/well)</p></li>
</ol>

<h3>Prepare patient PBMC</h3>

<ol>
<li><p> Thaw and count cells (resuspended in complete IMDM with rIL-2)</p></li>
<li><p> Make four 2-fold dilutions of 2.5 ml using up the total amount of
cells (e.g. 100,000/ml, 200,000/ml, 400,000/ml and 800,000/ml,
resulting in final concentrations of 10,000, 20,000, 40,000, and
80,000 cells/well)</p></li>
</ol>

<h3>Start co-cultivation in 96-well plates</h3>

<ol>
<li><p> Plate out 100 Âµl of PHA-stimulated target cells per well</p></li>
<li><p>Add 100 Âµl of patient cells per well (24 wells per dilution)</p></li>
<li><p>Wrap plastic foil around the plates</p></li>
<li><p>Incubate at 37Â°C/5% CO<sub>2</sub></p></li>
</ol>

<h3>Continuation of culture</h3>

<ol>
<li><p>Prepare PHA-stimulated target cells 2-3 days prior as described
above</p></li>
<li><p>Every seven days:</p><p>1.</p>
<ol>
<li> Resuspend the rest of the culture, transfer 65 Âµl to a fresh
plate containing 135 Âµl complete IMDM with rIL-2 with 100,000
target cells per well</li>
<li> Add 25,000 MT2 cells per well to the original plate</li>
<li> Score syncytia in this plate after 3 days</li>
</ol></li>
</ol>

<h3>Expand biological virus clones</h3>

<ol>
<li><p>When fewer than 33% of wells seeded with a certain concentration are
positive, the viruses in one well are thought to originate from one
infected cell.</p></li>
<li><p>Wells that show evidence of HIV-1 replication in that concentration
(in p24-ELISA and/or MT-2 culture) can be transferred to a tissue
culture flask (25 cm<sup>2</sup>) containing 5 x 10<sup>6</sup>
PHA-stimulated target cells in 5 ml complete IMDM with rIL-2</p></li>
<li><p>After 7 to 14 days virus containing cell-free culture supernatants
can be collected and stored at -70Â°C for viral stocks, cells viably
frozen and 10<sup>6</sup> cells stored in lysis buffer for isolation
of proviral DNA</p>
<h3>Calculations</h3>

<ol>
<li><p>The proportion of infected cells is determined according to the
formula for Poisson distribution: F=-ln(F<sub>0</sub>), in which
F<sub>0</sub> is the fraction of negative cultures.</p></li>
<li><p>Since CD4<sup>+</sup> T cells have been shown to be the most
important target for HIV-1 in the peripheral blood, virus load
is expressed as tissue culture infective doses per
10<sup>6</sup> CD4<sup>+</sup> T cells.</p><p><strong>Schematic overview of biological cloning
experiments</strong></p><p><strong><a href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/882-Biological-Cloning-of-HIV-1"><img src="https://hebe.mullins.microbiol.washington.edu/static/_img/f0/358a/cloning_59ec741897_320x206.gif" width="320" height="206" srcset="https://hebe.mullins.microbiol.washington.edu/static/_img/f0/358a/cloning_59ec741897_320x206.gif 1x, https://hebe.mullins.microbiol.washington.edu/static/_img/f0/358a/cloning_59ec741897_640x412.gif 2x" alt="cloning.gif"></a></strong></p></li>
</ol></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Sputum Protocol</title>
        <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/1378-Sputum-Protocol" rel="alternate" type="text/html" />
        <published>2010-03-30T13:57:49-07:00</published>
        <updated>2011-06-03T16:09:51+00:00</updated>
        <id>urn:uuid:e3c9eba7-8bac-50a2-83b8-d8bc10ec76c3</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>1 March 2002</p><p><strong><span class="underline">Reagents:</span></strong></p>
<ul>
<li><p>DPBS: Dulbecco&rsquo;s Phosphate Buffered Saline, calcium/magnesium free
(BioWhittaker #17-515F)</p></li>
<li><p>DTT: Sputolysin (Calbiochem #560000, 20x 10ml). Dilute the contents
of 1 vial to 100ml with sterile distilled water. Swirl gently to
dissolve any crystals; filter if necessary. Diluted solutions,
stored under N<sub>2</sub>, are stable for 48 hours at 2-8Â°C. After
opening, vials with undiluted concentrate can be stored under
N<sub>2</sub>at 2-8Â°C.</p></li>
</ul>
<p><strong><span class="underline">Protocol:</span></strong></p><p>Process sputum within 2 hours of collection.</p><p>Keep sputum on ice until ready to process.</p><p>Select opaque/dense sputum portions that are different from saliva and
free of squamous cell contamination for processing.</p><p>Weigh remaining sputum sample.</p><p>Add freshly prepared DTT equal to 2x weight of sputum portion.</p><p>Incubate 15 minutes at 37Â°C with frequent shaking.</p><p>Vortex every 5 minutes for 15 seconds.</p><p>Dilute with equal volume of DPBS.</p><p>Filter through 48 Âµm pore nylon gauze mesh filter.</p><p>Take sample for hemocytometer: obtain total cell count and viability.</p><p>Spin cells at 2000 rpm for 10 minutes (4Â°C).</p><p>Collect supernatant and store at -80Â°C.</p><p>Resuspend cell pellet in DPBS at 10<sup>6</sup>cells/ml.</p><p>Make cytospins with 60,000 to 120,000 cells per slide.</p><p>Fix and stain (May-Grunwald Giemsa, Wright, and/or Romanowski stains).</p><p>Use remaining cells for culture assays.</p><p><strong><span class="underline">References:</span></strong></p>
<ol>
<li><p> Pin et al. (1992)<em>Am Rev Respir Dis</em><strong>145</strong>:1265-1269.</p></li>
<li><p> Pin et al. (1992)<em>Thorax</em><strong>47</strong>:25-29.</p></li>
<li><p> Pizzichini et al. (1996)<em>Am J Respir Crit Care Med</em><strong>154</strong>:308-317.</p></li>
<li><p> Pizzichini et al. (1997)<em>Am J Respir Crit Care
Med</em><strong>155</strong>:1501-1508.</p></li>
<li><p> Lensmar et al. (1998)<em>Eur Respir J</em><strong>12</strong>:595-600.</p></li>
<li><p> Ward et al. (1999)<em>Clin Exp Allergy</em><strong>29</strong>:248-252.</p></li>
<li><p> Rutgers et al. (2000)<em>Eur Respir J</em><strong>15</strong>:109-115.</p></li>
<li><p> Purovicki et al. (2000)<em>Eur Respir J</em><strong>16</strong>:242-246.</p></li>
<li><p> Alexis et al. (2000)<em>Clin Immunol</em><strong>97</strong>:21-32.</p></li>
<li><p>Zeibecoglou et al. (2000)<em>J Allergy Clin Immunol</em><strong>106</strong>:697-704.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Processing Peripheral Blood from HIV-1 Infected Individuals</title>
        <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/1429-Processing-Peripheral-Blood-from-HIV-1-Infected-Individuals" rel="alternate" type="text/html" />
        <published>2010-03-17T10:52:32-07:00</published>
        <updated>2011-06-03T16:09:55+00:00</updated>
        <id>urn:uuid:5ed38297-e78f-56b5-98ff-b57fa4c739d8</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents</strong>:</span></p>
<ul>
<li><p>Ficoll-Paque Plus, Pharmacia (cat.no. 17-1440-02).</p></li>
<li><p>Phosphate buffered Saline (PBS), BioWhittaker (cat.no. 17-515F).</p></li>
<li><p>Tri Natrium Citrate Dihydrate (TNC), 38g/l.</p></li>
<li><p>ACK lysing buffer, BioWhittaker (cat.no. 10-548E).</p></li>
<li><p>peripheral blood sample (e.g. 50mls of heparinized blood)</p></li>
</ul>
<p><span class="underline"><strong>Protocol</strong>:</span></p>
<ol>
<li><p> Transfer blood to 50 ml tube.</p></li>
<li><p> Spin at 2000 rpm for 10 minutes.</p></li>
<li><p> Collect plasma and spin at 3000 rpm for 10 minutes.</p></li>
<li><p> Collect plasma and store at -80 Â°C.</p></li>
<li><p> Dilute remaining cell suspension with PBS/10%TNC to 50 ml.</p></li>
<li><p> Fill two 50 ml tubes with 12.5 ml Ficoll-Paque Plus each.</p></li>
<li><p> Gently pipette 25 ml of the diluted cell suspension on top of each
12.5 ml of Ficoll-Paque Plus.</p></li>
<li><p> Spin 20 minutes at 2000 rpm at room temperature. No brake!</p></li>
<li><p> Transfer the white blood cell ring fraction to a new 50 ml tube
using sterile Pasteur&rsquo;s pipette.</p></li>
<li><p>Adjust the volume to 50 ml using PBS/10%TNC.</p></li>
<li><p>Spin 10 minutes at 1700 rpm.</p></li>
<li><p>Discard the supernatant.</p></li>
<li><p>Resuspend each pellet in 2 ml ACK lysing buffer to lyse remaining
erythrocytes.</p></li>
<li><p>Incubate for no more than 2 minutes at room temperature.</p></li>
<li><p>Adjust the volume to 50 ml using PBS/10%TNC.</p></li>
<li><p>Spin 10 minutes at 1200 rpm.</p></li>
<li><p>Resuspend the pellet and count the cells.</p></li>
</ol>
<p>Notes: Processing the blood this way will remove thrombocytes from the
plasma without activating them, so that plasma can be used for testing
of chemokine levels. Before starting Ficoll-Paque Plus and PBS with
10%TNC (v/v) should be at room temparature.</p><p>For specifics on appropriate handling and waste procedures please see
the<a href="http://mullinslab.microbiol.washington.edu/sops/ChemSOP.htm">online chemical
SOPs</a>or our
waste and spill notebook located in room 352.</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>BL3 Standard Operating Procedures</title>
        <link href="https://hebe.mullins.microbiol.washington.edu/protocols/tissue_culture_bl3/1388-BL3-Standard-Operating-Procedures" rel="alternate" type="text/html" />
        <published>2010-03-17T10:47:57-07:00</published>
        <updated>2011-06-03T16:09:59+00:00</updated>
        <id>urn:uuid:c64cc80e-e574-5ea2-a442-ae961df88c5b</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<h1>I. Authorization to Use the Mullins&#39; lab BL-3 Facility (B44C)</h1>
<p><em>This document must be read and an agreement/authorization sheet signed
and registered with Dr. Mullins.</em></p>
<ol>
<li><p> Entry to the BL-3 Facility is restricted to individuals who have
obtained prior approval. Authorization to use this facility is
contingent on the user&rsquo;s satisfactory completion of training,
understanding of the safety procedures described below, and on his
or her ability to follow these guidelines while using the facility.
Individuals with little or no prior experience working in a BL-3
facility must have an experienced individual working with them until
they become proficient in the safety techniques required.</p></li>
<li><p> Authorization to use the BL-3 facility requires review and
understanding of the following information:</p></li>
<li><ol>
<li> Practices outlined in the UW Biohazard Safety Manual, section IV
on Biohazard Control Procedures, section VI on Occupational
Health Program and section IX on Blood borne Pathogens.</li>
</ol>

<ol>
<li><p> The pamphlet from the CDC-NIH Biosafety in Microbiological and
Biomedical Laboratories, pages 25-30, BL-3 Standard
Microbiological Practices, Special Practices and Safety
Equipment; and pages 116-121, Viral Agents: Retroviruses,
Including HIV and SIV. The information in this booklet contains
recent information on laboratory-acquired infection with HIV as
well as guidelines for the use of biological safety cabinets,
cleaning and decontaminating spills, and management of
exposures.</p></li>
<li><p> The specific rules and procedures outlined in this document for
work in the Rosen B44C BL-3 facility.</p></li>
</ol></li>
<li><p> Authorization to use the BL-3 facility requires successful
completion of the following:</p></li>
<li><ol>
<li> Completion of the<a href="http://mullinslab.microbiol.washington.edu/protocols/bl3/BL3form_rev20060323.pdf">Mullins B44C BL-3 Facility Usage Authorization
Form</a>.
Make yourself a copy and turn in completed form to
Mullins/Mittler BL3 Lab supervisor (who will make a copy for BL3
Entry Notebook and give copies to appropriate supervisors).</li>
</ol>

<ol>
<li><p> Completion of the EHS course Bloodborne Pathogen Exposure
Control, required for laboratory employees working with human
blood and blood byproducts. Covers risk assessment, personal
protection, safe procedures, emergency response, and disposal of
biohazardous waste. Annual refresher training required. Register
online
at<a href="http://www.ehs.washington.edu/forms/classes/bpecrform.htm">http://www.ehs.washington.edu/forms/pso/bpecrform.php</a>or
call (206) 543-7201.</p></li>
<li><p> Completion of the EHS course, Biological Safety Practices (U
Conjoint 420), scheduled upon request, autumn only. If a user
already has extensive experience working in a BL-3 facility,
this course does not have to be taken prior to beginning their
work, but should be taken at the earliest possible convenience.</p></li>
<li><p> All users must have experience with tissue culture or working
with other human pathogens prior to working with HIV and SIV. A
laboratory orientation should be arranged with Dr. Mullins or
the BL-3 lab supervisor. At this time, proficiency in biosafety
techniques (use of the biosafety cabinets, microscopes,
centrifuge safety cups, and proper handling of media and waste
material, etc.) must be demonstrated.</p></li>
<li><p> Appointment with Occupational Health to cover the following:</p></li>
<li><ol>
<li> Hepatitis B immunization for work with blood or blood
products.</li>
</ol>

<ol>
<li> Counseling on working with HIV and SIV. This includes
receiving a drug prescription for post exposure prophylaxis
(PEP).</li>
<li> Drawing of serum sample prior to initiating work in the BL-3
facility. This sample will be stored in the event that HIV
seroconversion occurs in order to document the time of
seroconversion. They will not be tested without the consent
of the individual and then only after a documented exposure
occurs. Every 6 months samples can be drawn for HIV testing
(optional).</li>
</ol></li>
</ol></li>
</ol>

<h1>II. Entrance into the Facility</h1>

<ol>
<li> Food or drink is not permitted anywhere within the BL-3 laboratory
or anteroom.</li>
<li> Sandals and shorts are not allowed in the BL-3 facility.</li>
<li> Whenever possible, laboratory personnel should avoid handling
virus-containing material when he or she has cuts or skin abrasions
including, for example, eczema on the hands, wrists or face. If work
is necessary, and no replacement for that individual can be found to
perform the work, cuts and/or abrasions on the hands and/or wrists
should be thoroughly bandaged prior to donning gloves and entrance
to the facility. A full-face shield, in addition to the facemask,
should be worn to protect cuts and abrasions on the face.
Immuno-compromised individuals should not use the facility.</li>
<li> The following dress requirements are to be followed by all
individuals who use the facility regardless of the reason for entry:
within the anteroom and prior to entry to the facility each user
should put on one pair of nitrile gloves to cover at least two
inches of sleeve (the integrity of the gloves can be checked for
tears and punctures by flipping the gloves closed and observing that
the air trapped inside is not leaking). The user should then don
shoe covers, goggles (or glasses) and a face mask and enter the
facility. The gown should be put on immediately upon entrance to the
facility, followed by a second pair of latex long gloves. The inner
pair of gloves should never be removed or replaced while in the
facility unless a tear is suspected. Clean gowns will be provided in
the anteroom. Contaminated gowns should be changed immediately. It
should be emphasized that the reason for protective clothing is to
protect the worker from inadvertent spills of infected media. The
purpose of the shoe covers, for example, is to protect shoes from
inadvertent spills, however, THE FLOORS (AND ALL SURFACES) SHOULD BE
KEPT CLEAN OF SPILLS AND TRASH AT ALL TIMES. PROTECTIVE CLOTHING IS
NOT MEANT TO NOR WILL IT EVER REPLACE APPROPRIATE AND PRUDENT WORK
PRACTICES. Please note that the housekeeping staff are instructed
not to enter this room, you are responsible for keeping it clean.</li>
<li> The air pressure in the BL-3 facility should be between -0.05 and
-0.10. When the air pressure alarm sounds for a prolonged period of
time after entry into the facility and closing the door, all work in
the area should cease until the pressure has returned to normal.</li>
<li> Do not bring personal items into the lab.</li>
<li> Do not apply cosmetics while in the lab.</li>
<li> Workmen are only allowed to enter the facility if work is not
ongoing and with the approval of Dr. Mullins or the lab supervisor.
Workmen should be accompanied by someone authorized to enter the
BL-3 facility who will show them the appropriate dress requirements.
They should wear gowns and gloves but are not required to wear shoe
covers, goggles or facemask, as they will not handle infectious
materials.</li>
</ol>

<h1>III. Laboratory Procedures</h1>

<ol>
<li><p> <strong>General Considerations:</strong></p></li>
<li><ol>
<li> Failure to comply with the practices described below will result
in suspension of access privileges.</li>
</ol>

<ol>
<li> Double gloves are required to provide protection against
exposure to virus through gloves potentially weakened by
alcohol, skin oils, other chemicals and overuse. EHS recommends
changing your outer gloves every 30 minutes. At any time the
outer gloves have been contaminated with culture supernatant,
serum or infectious fluid, they should be removed and discarded
into the autoclave bag inside the hood. A clean pair of outer
gloves should be donned before continuing work. Gloved hands
that have been working in the hood, should be sprayed with
ethanol or changed prior to touching anything outside of the
hood. It is recommended that you wash your hands free of oils
and remove rings with sharp edges prior to putting on gloves. To
take gloves off, take hold of the glove at the wrist and peel
off inside out.</li>
<li><p> Chemical disinfectants for bloodborne pathogens:<br>
Care should be taken to minimize splashing when applying
chemical disinfectants such as bleach, Wescodyne, or ethanol.  </p><p><a href="http://mullinslab.microbiol.washington.edu/protocols/bl3/bl3rulesuw.htm#A">Appendix
A</a>describes
in detail our procedures for clean up of biohazard spills.  </p>
<ul>
<li><span class="underline"><strong>Chlorine Bleach</strong>(hypochlorite
solution ~6-8% hypochlorite)</span>: Use 2% (1:50 dilution
in water) for surfaces. Use 10% (1:10 dilution) for disposal
of liquids containing potentially hazardous pathogens or for
soaking heavily soiled tubes, vials etc. Use care - bleach
will corrode stainless steel. We use bleach routinely to mop
floors (1:50 dilution), for hood aspiration flasks (such
that full trap is a final of at least 1:10 bleach), and to
contain spills outside hood. Contact time should be at least
10 minutes.<br></li>
<li><span class="underline"><strong>Wescodyne</strong>(Iodophor compound -
0.175% Iodine)</span>: Use 1% (1:100 dilution in water) for
surfaces. Use 2.5% (1:40 dilution) for disposal of liquids
containing potentially hazardous pathogens or for soaking
heavily soiled tubes, vials etc. All spills inside hood
should be disinfected immediately with 2.5% Wescodyne
followed by with 70% ethanol (Wescodyne is corrosive to
stainless steel though much less so than bleach; it should
not be used on aluminum or copper). We routinely use 2.5%
Wescodyne solution in disinfectant buckets, pipet jars, and
for spills and splashes inside or outside the hood. Contact
time should be at least 10 minutes. Dilute solutions for
soaking materials should be changed daily.<br></li>
<li><span class="underline"><strong>70% Ethanol</strong></span>: Used to
disinfected work surfaces, gloves, plastic surfaces, paper
notes, instrument surfaces, and all surfaces where bleach or
Wescodyne are inappropriate due to their corrosive and
staining characteristics. DO NOT SPRAY ethanol directly into
hood or into a spill; use a soaked paper towel.</li>
</ul></li>
<li><p> Aerosols:</p>
<ol>
<li> Procedures with a high potential for creating aerosols, such
as vigorous shaking and vortexing should be performed in the
back third of the biological safety cabinet.</li>
<li> Avoid pouring or decanting virus suspensions.</li>
<li> Avoid vigorous pipetting and mixing. Do not forcibly expel
the last drop of suspension from a pipette. Discharge
pipetted material near the surface of fluid or down the wall
of a tube.</li>
<li> When opening culture tubes, bottles and flasks, manipulate
them slowly.</li>
<li> When resuspending liquid cultures, use a gentle swirling
action to create a homogeneous suspension. Once cultures are
resuspended, wait a few minutes before opening the
container.</li>
<li> Do not spray or pour disinfectants directly onto liquid
spills. Place absorbent paper towels over spill, then pour
10% bleach or 2.5% Wescodyne around and onto towels.</li>
</ol></li>
<li><p> GLASSWARE: Whenever possible, plasticware should be used. Avoid
use of glassware.</p></li>
<li><p> SHARPS: Hypodermic needles, razor blades, glass Pasteur pipettes
and other sharps which can easily penetrate the skin are
forbidden in the BL-3 facility unless their use is absolutely
necessary and specific permission for their use is obtained from
Dr. Mullins.</p></li>
<li><p> MOUTH PIPETTING: Mouth pipetting is not permitted. Use of a
mechanical pipetting device is required.</p></li>
<li><p> VACUUM: Vacuum lines must be protected with high efficiency
particulate air (HEPA) filters and liquid disinfectant traps
(containing 10% -100% bleach).</p></li>
<li><p> Avoid touching your face or any other exposed skin while in the
BL-3 facility.</p></li>
<li><p>Before using the phone, change outer gloves to clean pair. Swab
phone with 70% ethanol after use.</p></li>
<li><p>To avoid contamination of an entire notebook, write notes and
data in pencil or ethanol resistant pen on single sheets of
paper or paper towels. These can then be saturated with ethanol
before removing from the BL-3 lab. Protocols brought into the
BL-3 lab should be enclosed in a vinyl page protector so that
they can be cleaned with ethanol.</p></li>
</ol></li>
<li><p> <strong>Work in Biosafety Cabinets</strong></p>
<ol>
<li> The biosafety cabinet (class II, type A) is not designed for the
use of volatile toxic chemicals and volatile radionuclides and
therefore they cannot be used in this facility.</li>
<li> The height of the user&rsquo;s chair should be adjusted to allow
comfortable working and prevent a direct line of exposure to the
user&rsquo;s face during normal operation of the hood.</li>
<li> DO NOT TURN THE HOOD BLOWER OFF AT ANY TIME.</li>
<li> MANIPULATIONS OF POTENTIALLY INFECTIOUS MATERIAL shall be
conducted in the laminar-flow biosafety cabinets as follows:

<ul>
<li>Each user must clean the hood surfaces with 70% ethanol
before initiation of work and after completion of work.</li>
<li>Upon completion of work and your exit from BL3, the hood
should be clean and free of all material except the
followingPERMANENT HOOD RESIDENTS: tip boxes, pipettors,
marker, aspiration flask, bleach bottle.<strong>BEFORE LEAVING THE
BL3 CLEAN OUT YOUR WESCODYNE WASTE AND LEAVE EMPTY BUCKET BY
SINK FOR NEXT USER.</strong>If you have extenuating circumstances
for leaving other items in the hood LEAVE A NOTE WITH YOUR
NAME, TIMEDATE, AND WHEN YOU EXPECT TO RETURN TO CLEAN UP!</li>
<li>Place bucket (no more than Â¾ full) of fresh 2.5% Wescodyne
solution in hood.</li>
<li>Check aspiration flask. Aspirated liquid waste is collected
and disinfected in a 2 L aspiration flask charged with 200
mL undiluted bleach. After aspiration of infectious
materials, chase with bleach then 70% ethanol. Empty into
sink when ~Â¾ full; recharge with 200 mL undiluted bleach.</li>
<li>Manipulations should be performed as far back from the front
air grill as practical. Avoid placing anything on the front
or rear grills of the cabinet since these will disrupt the
airflow pattern and defeat the purpose of the cabinet.</li>
<li>Biological wastes must be exposed to 10% bleach or 2.5%
Wescodyne for at least minutes before sink disposal. NOTE:
Plastic tips and tubes/vials should be completely submerged
and pipettes should be filled to just below the plug. Upon
your final exit from the hood, decontaminated plastic
pipettes should be transferred to pipette jar. The Wescodyne
waste bucket should sprayed with ethanol, the contents
strained over the sink, and plastics discarded in small
biohazard bag.</li>
<li>Radioactive liquid waste will be disinfected with 10% bleach
in a separate bleach trap and then transferred to the main
lab and treated as general radioactive waste.</li>
</ul></li>
<li> TRANSPORT OF POTENTIALLY BIOHAZARDOUS MATERIALS (tubes for
centrifugation, culture dishes to be placed in incubators or
observed under microscope, etc&hellip;) should not leave the hood
without being properly sealed. Microscope slides containing
infectious materials should be transported and observed within
plastic petri dishes and examined while remaining within this
container if possible.</li>
<li> AVOID AEROSOLIZATION: Care should be taken to minimize the
splatter and/or aerosolization of infectious material inside the
hood (e.g. pipette tips should be ejected only when the tip is
present wholly within the confines of a plastic vessel
containing appropriate disinfectant).</li>
</ol></li>
<li><p> <strong>Centrifugation</strong></p></li>
<li><ol>
<li> <span class="underline">Bench Top Centrifuge</span>: Avoid tube
collapse by matching the rated speed of the tube with the
requirements of your experiment. Make sure to use the
appropriate set of matched buckets for the type of tube being
used.

<ul>
<li>All centrifugation conducted outside of the biosafety
cabinets must be performed using sealed rotors or secondary
buckets to contain potential aerosols, leaks, and tube
breakage.</li>
<li>After centrifugation, the sealed rotor or buckets should be
opened only inside a biosafety cabinet. These containers are
disinfected in the hood by wiping out carefully with 70%
ethanol. They cannot be autoclaved.</li>
</ul></li>
</ol>

<ol>
<li> <span class="underline">Microcentrifuge</span>: When
centrifuging infectious substances, the microcentrifuge should
be transferred into the hood for use and surface decontaminated
prior to removal.</li>
</ol></li>
<li><p> <strong>Using the Microscope</strong></p></li>
<li><ol>
<li> Tighten caps on flasks of infectious culture before transporting
to the microscope. Infectious cultures in plates or other
containers without snugly fitting lids should be carried to the
microscope in a tray.</li>
</ol>

<ol>
<li> When using the hemacytometer to count cells, enclose the
hemacytometer in a clean/disinfected petri dish with lid for
transport to the microscope and observation.</li>
<li> Change or spray gloves with ethanol before touching the
microscope.</li>
<li> Disinfect the viewing platform of the microscope after each use.</li>
<li> If you must remove your safety glasses to look through the
scope, don&rsquo;t forget to replace them.</li>
</ol></li>
<li><p> <strong>Waste Management</strong></p></li>
<li><ol>
<li> SHARPS:

<ul>
<li>Pipette tips and plastic pipettes are treated as
quasi-sharps because they can puncture autoclave bags.
Therefore, after decontamination and straining/draining,
they must be double-bagged before autoclaving.</li>
<li>Metal sharps that will easily penetrate the skin are not
allowed in the BL-3 facility without special permission.
Upon completion of the work after at least a 30-minute
exposure to bleach, the decontaminated sharps are
transferred to a red sharps container to await autoclaving.</li>
</ul></li>
</ol>

<ol>
<li> SOLID WASTE other than sharps generated inside the hood (vials,
tubes, culture flasks, etc.) should be decontaminated, drained
then placed directly into the large biohazard bag to await
autoclaving. Solid wastes generated outside the hood (paper
towels, outer gloves, shoe covers, etc.) are placed directly
into the large biohazard bag to await autoclaving.</li>
<li> LIQUID WASTE collected in a bleach trap or a 2.5% Wescodyne
solution within the biosafety cabinet must be exposed to
disinfectant 10 minutes before sink disposal.</li>
</ol></li>
<li><p><strong>Waste Sterilization</strong></p></li>
<li><ol>
<li> All solid waste and glassware should be autoclaved for at least
60 minutes at 132Â°C. Liquid waste must be autoclaved for at
least 60 minutes per gallon at 121Â°C. Laundry should be
autoclaved for 30 minutes at 121Â°C.</li>
</ol>

<ol>
<li> All material to be autoclaved should have appropriate autoclave
tape attached to confirm that the correct temperature was
attained.</li>
<li> A chemical indicator (i.e. steristrip) is placed in the center
of EACH LOAD to confirm proper decontamination conditions.
Biological testing systems are required at monthly intervals.
Records of the temperature, time, results of chemical indicators
and biological testing systems must be maintained for each load
of waste autoclaved for one year.</li>
</ol></li>
<li><p><strong>Identification and Storage of Materials</strong></p></li>
<li><ol>
<li> All equipment and materials in the BL-3 facility should be
treated as if they are contaminated.</li>
</ol>

<ol>
<li> Storage vessels containing biohazardous materials including
cultures in incubators and refrigerators and freezers should be
labeled to identify their contents, owners, and date.</li>
<li> All equipment such as refrigerators, freezers, incubators, cell
counters, centrifuges, etc. used for or containing biohazardous
materials must be labeled clearly with the appropriate
biohazards symbol.</li>
</ol></li>
<li><p><strong>Laboratory Transport</strong></p></li>
<li><ol>
<li> Live infectious materials, which are removed from the facility
for storage in liquid nitrogen or -70Â°C freezers should be
stored in nonbreakable, cryovials with rubber gasket seals. The
vials are surface decontaminated with 70% ethanol after sealing
and then transported to the freezers in nonbreakable,
impermeable closed containers with biohazard symbols. These
containers are assembled and then surface decontaminated prior
to exit from the facility.</li>
</ol></li>
</ol>

<h1>IV. Exiting the Facility</h1>

<ol>
<li><p> <strong>Prior to exiting the facility,</strong>each user should check to ensure
that he or she has:</p></li>
<li><ol>
<li> Appropriately cleaned and disinfected all work areas</li>
</ol>

<ol>
<li><p> Organized tools/supplies into correct storage location</p></li>
<li><p> Disposed of generated waste in the proper manner</p></li>
<li><ol>
<li> If the solid waste bag is Â¾ full, it must be secured with a
single wrap with rubber band and placed in autoclave tray by
door. If enough autoclave trays are filled, run autoclave.</li>
</ol>

<ol>
<li> If the sharps container is full, it is to be surface
decontaminated, transferred to the anteroom, tagged with
autoclave tape and autoclaved.</li>
<li> When pipette jar outside hood is Â¾ full, the pipettes are
to be removed from the tank and allowed to drain in the
sink. The pipettes are double-bagged before autoclaving.</li>
</ol></li>
<li><p> Adjusted the water level in the water bath and confirmed that
the temperature is set for 37Â°C</p></li>
<li><p> Turned off the aspirator and mechanical pipettor</p></li>
<li><p> Turned off the microscope and centrifuges</p></li>
<li><p> Wiped down all used switches, handles, and control panels with
70% ethanol</p></li>
</ol></li>
<li><p> Before exiting the work area, users should remove their protective
gear in the following order:</p></li>
<li><ol>
<li> 1. Shoe covers (spray shoe soles with ethanol)</li>
</ol>

<ol>
<li> 2. Outer gloves (spray inner gloves with ethanol)</li>
<li> 3. Mask</li>
</ol></li>
</ol>
<p>EXIT THE WORK AREA</p>
<ol>
<li> In the anteroom remove:

<ol>
<li> goggles</li>
<li> gown</li>
<li> inner gloves</li>
</ol></li>
<li> Shoe covers, gloves and masks are disposable and should be placed in
the solid waste bins. should be placed in the appropriate bin
(yellow bags) in the anteroom to await autoclaving.</li>
<li> Hands should be washed in the anteroom prior to leaving the
facility.</li>
</ol>

<h1>V. Emergency Procedures</h1>

<ol>
<li><p> Laboratory Accidents</p></li>
<li><ol>
<li> <span class="underline">Personal Injury or Exposure</span>: All
equipment in the BL-3 facility should be treated as if it were
contaminated. Any cuts or abrasions obtained while in the
facility should be immediately scrubbed for 10 minutes with 1%
Wescodyne, soap and water. For mucous membrane exposure,
thoroughly flush the surface for several minutes. There is an
eye wash fountain located in the BL-3 facility. The user should
then exit the facility using appropriate exiting procedures and
seek immediate medical attention with the Occupational Health
nurse practitioner, room NN256A; phone number (206) 548-4848. If
the accident occurs after hours, go directly to the UW Medical
Center emergency room. The occupational nurse/emergency room
will evaluate the wound, draw a blood sample and give any
necessary treatment; including HAART. The incident should be
reported to Dr. Mullins or the lab supervisor and an Accident
Report Form filed with EHS within 24 hours of the exposure.</li>
</ol>

<ol>
<li> <span class="underline">Centrifuge Malfunctions</span>:
Centrifuge malfunctions should be handled in such a way as to
avoid personal injury or exposure. If an imbalance occurs or a
bucket is thrown from the rotor, the unit should immediately be
turned off. Even in non-emergency situations, centrifugation is
a procedure that is potentially hazardous when working with
biohazardous material. Aerosols can be detected during the
filling of centrifuge tubes, removal of caps or removal of
contents. Breakage of tubes during centrifugation produces the
greatest amount of aerosol. Safety sealed centrifuge cups will
not allow the escape of contents or an aerosol in the event of
an accident, provided that they are sealed properly and only
opened in a biological safety cabinet.</li>
<li> <span class="underline">Fire Alarm</span>: If working with live
materials, the cultures should be returned to the incubator and
the facility should be exited using the appropriate exiting
procedures.</li>
<li> <span class="underline">Earthquake</span>: Flying glass from the
hood and sliding or falling heavy equipment are the primary
dangers during an earthquake. Move immediately away from the
front of the hood, freezer and stacked incubator. Stand flush
against the wall. Watch for falling equipment and supplies. Some
users may be able to duck under the knee space on the hood,
which will lend some protection from overhead. After the
earthquake, survey the area for biological or chemical spills;
clean the spills only if the area is safe. If the area is not
safe and the spill occurred in the hood, remove the lid of the
dilute Wescodyne solution and overturn it in the hood. Leave as
quickly as possible following the appropriate exit procedures.
If there is time, leave a note on the door stating that a
biological spill has occurred.</li>
</ol></li>
</ol>
<p><span id="A"></span></p><p><strong>APPENDIX A - CLEAN-UP OF BIOHAZARDOUS SPILLS</strong></p>
<ol>
<li><p> <strong>Biohazardous Spills in the Biological Safety Cabinet</strong><br>
Chemical decontamination procedures should be initiated at once
while the cabinet continues to operate to prevent escape of
contaminants from the cabinet.</p></li>
<li><ol>
<li> It is best to soak the spill into paper towels and pour 2.5%
Wescodyne such that it seeps into the paper towels rather than
pouring directly onto the spill and generating aerosols. Allow
the detergent to act for 10 minutes then transfer soaked paper
towels to an autoclave bag within the hood. Wipe walls, work
surfaces, and equipment with detergent. The operator should be
in protective gear during this procedure.</li>
</ol>

<ol>
<li> If the spill has spread to the catch basin underneath the front
grill, wipe the grill with 2.5% Wescodyne, remove the grill and
place it in the hood, soak up liquid in the catch basin with
paper towels, and disinfect with Wescodyne as in &ldquo;A&rdquo; above.
After paper towels have been removed, replace grill.</li>
<li> Seal and decontaminate the outside of the autoclave bag used to
collect the soaked paper towels, remove from the hood and
autoclave.</li>
</ol></li>
<li><p> <strong>Biohazard Spill Outside of a Biological Safety Cabinet</strong></p></li>
<li><ol>
<li> Holding your breath leave the room immediately and close the
door.</li>
</ol>

<ol>
<li> Warn others not to enter the contaminated area. Post a sign on
the door if you leave the immediate vicinity.</li>
<li> In the anteroom, remove and properly dispose of contaminated
garments and protective gear. Thoroughly wash hands and face.</li>
<li> Wait 30 minutes to allow dissipation of aerosols created by the
spill.</li>
<li> Put on clean protective gear before reentering the room. If the
spill was of high titer virus, the use of a respirator and tight
fitting goggles should be considered.</li>
<li> Use paper towels to soak up the liquid. Then pour detergent
around the spill such that it flows into the towels. To minimize
aerosolization, avoid pouring directly into the spill.</li>
<li> Let stand 20 minutes to allow adequate disinfectant contact
time.</li>
<li> Using a dustpan and sponge or small broom transfer all
contaminated materials into an autoclave bag with as little hand
contact as possible. If there is broken glass involved, transfer
to a deep autoclave pan instead. DO NOT ATTEMPT TO PICK UP ANY
BROKEN GLASS BY HAND!</li>
<li> Prepare a container of dilute detergent and sponge off the
floor, removing as much liquid as possible.</li>
<li>Autoclave waste along with the dustpan and sponge. If the broom
cannot be autoclaved, let it soak in 5% Wescodyne for 30 minutes
or more and then rinse.</li>
<li>Report the spill to Dr. Mullins or the BL-3 lab supervisor.</li>
</ol></li>
<li><p> <strong>Radioactive Biohazard Spill Outside a Biological Safety Cabinet</strong></p></li>
<li><ol>
<li> Follow A-D from above. Before clean-up procedures begin, contact
a radiation safety officer (543-6328). The spill should be
surveyed for external radiation hazard prior to determining the
course of action.</li>
</ol></li>
</ol>

<h4><strong>Mullins&#39; B44C BL-3 Facility</strong></h4>
<p>I, (print name)
_______________________________________,
have read, understand and will comply with the safety practices outlined
in the University of Washington Biosafety Manual, the CDCâ€¢NIH
guidelines for Biosafety Level 3 practices and the Mullins&#39; lab rules
and regulations regarding the Rosen B44C BL-3 facility.</p><p>Lab of Trainee
(PI):__________________________________</p><p>Trainee Lab
Trainer:__________________________________(assigned
by PI)</p><p>Trainee
Name:__________________________________</p><p>Signature:__________________________________</p><p>Mullins Lab
Trainer:_________________________________________</p><p>Date Trained:____________________</p><p>Additional Comments:  </p><p>The person named above has successfully completed training supervised by
Dr. Mullins or the BL-3 lab supervisor and is now authorized to use the
Rosen B44C BL-3 facility.</p><p>__________________________________
(James I. Mullins)</p><p>__________________________________
(Date)</p><p>For specifics on appropriate handling and waste procedures please see
the<a href="http://mullinslab.microbiol.washington.edu/sops/ChemSOP.htm">online chemical
SOPs</a>or our
waste and spill notebook located in room 352.</p>

]]>
        </content>
    </entry>
    

    
</feed>